Supplementary MaterialsSupplementary Materials: Supplementary Material 1: Figure R1: the 2-DG abated T-006 protective effects on 6-OHDA-induced cytotoxicity. metabolism and mitochondrial biogenesis that were induced by 6-OHDA in PC12 cells. In addition, animal experiments showed that administration of T-006 significantly attenuated the 6-OHDA-induced loss of tyrosine hydroxylase- (TH-) positive neurons in the SNpc, as SA 47 well as dopaminergic nerve fibers in the striatum, and also increased the concentration of dopamine and its metabolites (DOPAC, HVA) in the striatum. Functional deficits were restored following T-006 treatment in 6-OHDA-lesioned mice, as demonstrated by improved motor coordination and rotational behavior. In addition, we found that the neuroprotective effects of T-006 Rabbit polyclonal to AACS were mediated, at least in part, by the activation of both the PKA/Akt/GSK-3and CREB/PGC-1and models. Open in a separate window Figure 1 Neuroprotective effect of T-006 on 6-OHDA-induced neurotoxicity in PC12 cells. (a) Chemical structure of T-006. (b) PC12 cells were treated with different concentrations of T-006 or Triton X-100 (0.1%, 0.001 compared to the control group; ?? 0.01 and ??? 0.001 compared to the 6-OHDA-treated group. 2. Materials and Methods 2.1. Materials 6-OHDA, dimethyl sulfoxide (DMSO), paraformaldehyde (PFA), and thiazolyl blue tetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO, USA). A lactate dehydrogenase (LDH) kit and cocktail were purchased from Roche Applied Science (Indianapolis, IN, USA). F-12K medium, FBS, HS, penicillin-streptomycin (PS), trypsin-EDTA, and PBS were purchased from Life Technologies (Grand SA 47 Island, NY, USA). Enhanced chemiluminescence (ECL) solution was obtained from Thermo Fisher Scientific (Rockford, IL, USA). RIPA lysis buffer was bought from Beyotime Biotechnology (Shanghai, China). H-89 was purchased from Selleck Chemicals (Shanghai, China). SYBR? Premix Ex Taq? II kit was purchased from TaKaRa. (Dalian, China). Antibodies against p-PKA, PKA, p-Akt, Akt, p-CREB, CREB, p-PI3K, SA 47 PI3K, p-GSK-3and NRF-1 levels were determined by Western blot analysis as described below. 2.6. Western Blot Analysis Protein levels were examined using Western blot analysis as previously described [23]. Briefly, after appropriate treatment, the collected cells were lysed with RIPA lysis buffer. For the brain samples, tissues were homogenized in RIPA lysis buffer supplemented with protease inhibitor PMSF and cocktail as per manufacturer’s instruction to extract protein. Protein concentration was measured by a BCA protein assay kit. The same amounts of protein samples were SA 47 electrophoresed on SDS-polyacrylamide gel, transferred to PVDF membrane. Membranes were subsequently incubated overnight at 4C with various major antibodies in 5% fat-free dried out milk-TBST [each antibody was diluted at 1?:?1000: phospho-PKA (Thr197), PKA, phospho-Akt (Ser473), Akt, phospho-CREB SA 47 (Ser133), CREB, phospho-GSK-3(Ser9), GSK-3(1?:?500), NRF1 (1?:?500), and TFAM (1?:?500)]. The blots were incubated with HRP-conjugated secondary antibody in TBST at a 1 then?:?5000 dilution for 1?h in room temperature. Proteins rings had been visualized with a sophisticated chemiluminescence (ECL) package. Blots had been repeated at least 3 x for each and every condition. After advancement, the density from the rings was quantified by Picture Lab Software program (Bio-Rad, Hercules, CA, USA). 2.7. Evaluation of mtDNA Duplicate Number The duplicate amount of mtDNA was dependant on real-time quantitative PCR as previously referred to, with minor adjustments [24]. Real-time PCR using the SYBR? Premix Former mate Taq? II package was performed with an qPCR (Agilent Systems, Santa Clara, CA, USA). The next primer sequences had been utilized: D-loop-F, GGTTCTTACTTCAGGGCCATCA; D-loop-R, GATTAGACCCTGTACCATCGAGAT; 18s rRNA-F GCAATTATTCCCCATGAACG; 18s rRNA-R, GGCCTCACTAAACCATCCAA. Comparative mtDNA copy quantity was determined with the two 2? 0.001 when compared with the control group; ? 0.05, ?? 0.01, and ??? 0.001, when compared with the 6-OHDA-treated group. 2.11. Behavioral Evaluation For the rotation test, mice received a subcutaneous injection of apomorphine (0.5?mg/kg) in 0.9% saline [26]. Turning behavior was monitored directly after.
Categories