Total genome sequence of cell culture-attenuated guinea pig cytomegalovirus cloned as an infectious bacterial artificial chromosome. suggest that the mutation is definitely a significant contributor to attenuation of N13R10, likely by abrogating manifestation of a functional PC. IMPORTANCE Cells tradition adaptation of cytomegaloviruses rapidly selects for mutations, deletions, and rearrangements in the genome, particularly for viruses passaged in fibroblast cells. Some of these mutations are focused in the region of the genome encoding components of the pentameric complex (Personal computer), in particular homologs of human being cytomegalovirus (HCMV) proteins UL128, UL130, and UL131A. These mutations can attenuate the course of illness when the disease is definitely reintroduced into animals for vaccine and pathogenesis studies. This study demonstrates that a deletion Mequitazine that arose during the process of cells culture passage can be repaired, with subsequent repair of Mequitazine pathogenicity, using BAC-based mutagenesis. Repair of pathogenicity by restoration of a frameshift mutation in GPCMV gene using this approach provides a important genetic platform for future studies using the guinea pig model of congenital CMV illness. INTRODUCTION Illness with human being cytomegalovirus (HCMV) is definitely a leading cause of disability in newborns, and development of an effective vaccine is definitely a major general public health priority (1, 2). Preclinical modeling of vaccines against congenital illness must rely on the study of species-specific CMVs, since HCMV will not infect Mequitazine nonhuman cells (3, 4). The study of guinea pig cytomegalovirus (GPCMV) is particularly important, since this disease will mix the placenta and infect pups compared to pathogenic salivary gland (SG)-adapted disease. Related work from additional organizations experienced previously shown that a GPCMV lacking a 1.6-kb region of the viral genome was attenuated (10). Attenuation of N13R10 was observed in studies in which a high dose (108 PFU) was given to young female guinea pigs. This dose of disease produced transient viremia and impaired weight gain, but did not cause mortality (11). A dose of 5 105 PFU given to pregnant animals caused congenital infections in 60% of live-born pups but relatively low (17%) pup mortality (12). In contrast, challenge of pregnant guinea pigs with considerably lower doses of virulent, SG-adapted disease is definitely highly pathogenic and and (ii) a missense mutation in 3 of the 4-bp deletion/frameshift (14, 15). Work published by several investigators offers elucidated that encode three FLJ31945 subunits of a protein complex analogous to the pentameric complex (Personal computer) that mediates access of HCMV into monocytes and epithelial/endothelial cells (10, 16,C18). Deletion of this locus or disruption of individual genes in GPCMV offers previously been hypothesized to contribute to attenuation (10). The absence of additional deletions or mutations impacting annotated coding sequences in the N13R10 genome (14) strengthened this hypothesis and prompted us to examine whether loss of GP129 accounted for attenuation of N13R10 disease. To test this hypothesis, we repaired the N13R10 region to match that of the SG stock of GPCMV and then evaluated the mutant parental disease (N13R10) and repaired disease (r129) for growth properties and gene manifestation and for virulence and contribute to the attenuation of N13R10. The improved pathogenicity of r129, which can be manipulated using BAC genetics, will greatly facilitate vaccine and pathogenesis studies in the GPCMV model of congenital illness. MATERIALS AND METHODS Disease and cells. Cell tradition propagation of disease was carried out in guinea pig lung fibroblast cells (GPL cells [ATCC CCL158]) managed in F-12 medium supplemented with 10% fetal calf serum (FCS [Fisher Scientific]), 10,000 IU/liter penicillin, 10 mg/liter streptomycin (Gibco-BRL), and 0.075% NaHCO3 (Gibco-BRL). Growth curves and viral titers were determined as explained previously (9). Building of N13R10-r129 BAC and reconstitution of viruses N13R10 and r129. BAC N13R10 contains the total GPCMV strain 22122 genome (9), having a deletion that disrupts open reading frames (ORFs) and cassette encoding galactokinase. To generate this deletion create, oligonucleotides GP129-galk-FW (CGCCGATTCTATCGCTTGCCTGCTAATAAATTGGAACTGGACGTGATAAAACGACTCACTATAGGGCGAATTGG) and GP129-galk-RV (TACTTCCCGTTACCATCGACTGAATAAAACTCGCTACCGCAGACGTCCACGCTATGACCATGATTACGCCAAGC) were synthesized to consist of 50 bp of GPCMV sequences (underlined) flanking the region to be erased followed by 24-bp sequences complementary to plasmid pencoding the cassette (19). Using Mequitazine GP129-galk-FW and GP129-galk-RV as primers and pDNA as the template, a 1.5-kb PCR product was produced containing the cassette flanked by 50-bp GPCMV targeting homologies. The product was purified using a Qiagen PCR purification kit, restricted with DpnI to break down any residual pDNA, and then phenol-chloroform extracted and ethanol precipitated. Heat-induced electrocompetent strain SW102 (9) cells comprising BAC N13R10 were produced as.
Categories